sharidler sharidler

16-12-2022
Biology

contestada

original DNA: TACTTTAATCCCAAATTTACT DNA: TACTATAATCCCAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ?

Respuesta :

Otras preguntas

What is the simplified form of expression c^9d^ -7/c^14 d^-10

Old oceanic crust is more dense than new oceanic crust because

PLEASE HELP In this excerpt from act I of Shakespeare's Romeo and Juliet, which figure of speech does Romeo use repeatedly to describe how he feels about Rosali

Why is soda considered bad for your teeth, particularly if you don't brush regularly?

Write 2litres 700 millilitres to the nearest litre

The diagonal of a TV set is 52 inches long. It's length is 28 inches more than the heigh. Find the dimensions of the TV set.

What is single kind of organism that can reproduce on its own?

The Party emphasized the role of ordinary or common citizens.

How many moles of ethyl alcohol, C2H6O, are in a 18.0 g sample?

16 more than 8 of a certain number is 24 more than 6 times that number. What is the number?