marandajane marandajane

19-01-2023
Biology

contestada

Transribe and translate the following dna strand
GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

Respuesta :

Otras preguntas

What were the two main reasons many wanted war with England when Madison became President? In other words, what were two things England started doing again the

Lyme disease is spread in the northeastern United States by infected ticks. The ticks are infected mainly by feeding on mice, so more mice result in more infect

I need help on this question

Giving brainliest for first right answer

Jamestown Furniture Mart, Inc., sold $ 80,000 of furniture in May to customers who used their American Express credit cards. Such sales are subject to a 3 per c

Heyy!! can u pls help me

I will give brainiest to whoever answers correctly !!

Two blocks of masses M and 3M are placed on a horizontal, frictionless surface. A light spring is attached to one of them, and the blocks are pushed together wi

A person lying on an air mattress in the ocean rises and falls through one complete cycle every five seconds. The crests of the wave causing the motion are 20.0

The female sex cell is called a(n) O A) egg O B) sperm O C) zygote OD) diploid PLEASE HELP