farhanabadar86 farhanabadar86

19-03-2024
Biology

contestada

An mRNA codon for the amino acid Alenine is GCC. How many Alenine molecules are present in polypeptide containing 8 amino acid code for, the following DNA template
TCGGCCTACCGGGCCCATGCCAAT

Respuesta :

Otras preguntas

Select ALL the correct answers. Consider the graph given below. A diagonal curve declines from (negative 2, 10), (0, 6), (1, 4), (2, 2), (3, 0), (4, negative 2

Can anyone solve this for me I give you brainliest thing

A woman bought some large frames for $19 each and some small frames for $9 each at a closeout sale. If she bought 18 frames for $222, find how many of each type

In which type of government as a single individual typically possess absolute political power

In the context of this passage, what is fair? Consider your current justice system. In what ways, if at all, are law and punishment weighed against certain peop

Are those rational or irrational : a. 8.7462 b. 13.831 c. 15.403

Hello how do u spell A in letters Is it like this AY

which of the following ions are directly involved in the generation of an action potential?

Since angle B is the largest angle, Line segment A C is the ________ side.

This excerpt gives an example of _____ irony dramatic situational verbal intentional