mya1182
mya1182 mya1182
  • 17-06-2019
  • Chemistry
contestada

what is internal energy is

Respuesta :

dvclee2
dvclee2 dvclee2
  • 17-06-2019

Answer:

According to Brittanica, "Internal energy [is] the property or state function that defines the energy of a substance in the absence of effects due to capillarity and external electric, magnetic, and other fields."

Answer Link

Otras preguntas

A car manufacturer claims that their car can get 32 miles per gallon minus the speed factor. This can be modeled by the linear equation f(x) = 32 -0.15x where f
Provide a food web for Grassland starting with the Earth's primary source of energy.​
Suppose the average yearly salary of an individual whose final degree is a masters is $36 thousand less than twice that of an individual whose final degree is a
Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCC
If we increase the amount of work being done, and all other factors remain the same, the amount of power would​
The lac operon consists of a coding region, which contains three genes that code for proteins needed to metabolize lactose, and a regulatory region, which regul
use the information you gathered to identify the minerals,then move the stickers to the minerals.
what does 590x89 equals ??
which nation uses the most geothermal power A: POLAND B: AUSTRIA C: GREENLAND D: ICELAND
Do you believe that European Colonizers were immoral in their actions towards native populations