emgracedorminey emgracedorminey
  • 18-03-2020
  • Chemistry
contestada

which measurement could describe the velocity of an object

Respuesta :

scarbine166
scarbine166 scarbine166
  • 20-03-2020

Answer:

Distance (in meters) and time (in seconds) both have an effect on Velocity

Explanation:

Answer Link

Otras preguntas

A satirical picture or drawing that lampoons a politician or political situation is called:________
Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCC
During the first treatment condition of a within-subjects experiment, the participants learn a new skill that helps improve their performance in later treatment
cos x° = sin(3x+10°) find tan x°​
Select all that apply. What characteristics do these words have in common? halibut, flounder, tuna, trout fish fresh water salt water edible
Calcutale Grxn for the following equation at 25°C: 4KClO3(s) → 3KClO4(s) KCl(s)
True or false 12,785.000 has five significant digits.
how do elections help limit the power of government?
1) Maya needs 54 cubic feet of soil for her garden. She already has 4.5 cubic feet ofsoil. Each bag contains 1.5 cubic feet of soil. How many bags of soil shoul
Pls check is there any mistake. If yes pls inform me​