Pokecobrajoe03
Pokecobrajoe03 Pokecobrajoe03
  • 19-10-2020
  • Mathematics
contestada

Solve the equation
(1/2)-sinx=1

Respuesta :

liliana1283
liliana1283 liliana1283
  • 19-10-2020

Answer: #2. sin x (sin x + 1) = 0

sin x = 0 or sin x + 1 = 0

sin x = 0 or sin x = -1

Step-by-step explanation:

Answer Link

Otras preguntas

Plssssss can anyone help me plsssss What is the rate of change?​
Simplify * 1-9 6-(-2)
Which of the following values are solutions to the inequality 4+2x\le 4?4+2x≤4? \text{I.}\hspace{2px}0\hspace{20px}\text{II.}\hspace{2px}-4\hspace{20px}\text{II
Animals eat plants and convert the chemical energy contained in them into
Coding of a Polypeptide by Duplex DNA The template strand of a segment of double-helical DNA contains the sequence (59)CTTAACACCCCTGACTTCGCGCCGTCG(39) (a) What
Due to lack of _______ to use for building cabins, many of the prairie home were made of ___________? money; adobe money; mud trees; sod logs; mud
Numbers 24:17 calls Jesus a ______ ♡︎Scepter ♡︎Saint ♡︎Savior
Find the percent change: $350 to $400
Choose true or false for each statement.
60% of the Canadian population lives in the provinces of Quebec and __________. A. Alberta B. Ontario C. Manitoba D. Saskatchewan