Carlie2024 Carlie2024

20-10-2020
Computers and Technology

contestada

True or false
A compiler translates a source program one line of code at a time.

Respuesta :

arianna9588 arianna9588

20-10-2020

Answer:

True

Explanation:

yes It translates one line at a time to be able to confirm all information.

Answer Link

CaptSteamer CaptSteamer

20-10-2020

Answer:

True

Explanation:

I hope this helps you

Answer Link

Otras preguntas

help pls its iready ill give brainiest

The medical name for the foot bones are? A:Tarsals B:Phalanx C:Phalange D:Metatarsals

Use the restriction enzyme EcoRi to cut DNAVictim DNA : GGAAG ATTCTACATTACTGACGGACGTGACGTGA CCTTCTTAA GATGTAATGACTGCCTGCACTGACT Number of restriction fragments

Whats your opinion about same sex marriage?

In the ordered pair below, which value represents the input to a function? (3, 18)

I really need help. I need to have this done today but I'm having trouble with it. PART A Replace direct complements with pronouns. Write the new sentence. 1. M

1. A 2. B 3. C 4. D Help?

Which statement is the best description of Martin Luther King Jr.’s central claim in the speech as a whole?

What is 1/2 as a present

Which author is well known for his “twist” endings? Edgar Allen Poe Herman Melville Nathanial Hawthorne O. Henry