malayalouns malayalouns
  • 18-11-2020
  • Mathematics
contestada

-11 1/4 degrees and 11 degrees

Respuesta :

vlcooktraylor
vlcooktraylor vlcooktraylor
  • 18-11-2020

Answer:

the  answer  is  -0.00436332313 rad

Step-by-step explanation:

Answer Link

Otras preguntas

"discuss several factors that contributed to the economic collapse of late 2008," asks a question on the midterm in an economics course. such a question is a te
a nonlinear system of inequalities consists of two or more inequalities. ____ of these is/are nonlinear
An average person's heart beats about 103,680 times a day. Write and solve an equation to find about how many times the average person's heart beats in one min
Where might water be found on the moon
Radium is a member of the alkaline earth family. In addition to being a part of this family, what is another property of radium that you can deduce from the inf
What is 16x^2+14x-15 divided by 2x+3
Anna is making a presentation on the top five leading companies in her state. She wants to make sure that she does not put in too much information and slides on
Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’
John predict the basketball team score 68 points if the basketball team actually scored 49 points what is John’s percentage error on your answer to the nearest
Some Japanese women immigrate to America despite the passport ban. They found a way to marry men who were already in America. What were these women called?