bhadliya bhadliya
  • 16-12-2020
  • Chemistry
contestada

Help with this question pleasee

Help with this question pleasee class=

Respuesta :

cherish71
cherish71 cherish71
  • 16-12-2020
Solids. Example: when you hit a drum, it vibrates, then the sound travels through the air, to your ears.
Answer Link
bigoleturkey15 bigoleturkey15
  • 16-12-2020
The answer would be solids
Answer Link

Otras preguntas

what was the name of the leader of the stono rebellion
thank you!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
What grace is and how it could affect a person’s actions and attitudes?
Corey wants to watch a 210 minute movie, but he can't watch it all at once. If he watches [tex]\frac{1}{7}[/tex]of the movie each day of the week, how many minu
please help im so confused
A. different elements of weather and climate B. description of each elements of weather and climate C. explanation how different elements affect weather and cl
Use the restriction enzyme EcoRi to cut DNAVictim DNA : GGAAG ATTCTACATTACTGACGGACGTGACGTGA CCTTCTTAA GATGTAATGACTGCCTGCACTGACT Number of restriction fragments
How does priestly present mr Birling as a selfish character ?
How many moles are in 22.0 grams of H2O?
Based on the video you just watched, what is contributing to the change in sea level in the Northern Patagonian Ice Field. Why is this area important for climat