figueroamelany316 figueroamelany316

19-12-2020
Biology

contestada

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Respuesta :

raduoprea160 raduoprea160

19-12-2020

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

Answer Link

Otras preguntas

Whats the answer to this?

fill in the other coordinate for the line 7x - 5y =21:(4 , ?)

If the discriminant of a quadratic equation is -4, how many solutions does the equation have? 0 1 2 no real solutions

Ivan pushes a dresser with full drawers across his carpeted floor. What could Ivan do to reduce the amount of friction between the dresser and the floor?

What is the answer to this?

Identify the polynomial written in ascending order. (1 point) 3x3− 5x2+ 4x − 7 −5x2+ 4x + 3x3− 7 −7 + 4x − 5x2+ 3x3 4x + 3x3− 7 − 5x2

You invest an initial 100 in an account that has an annus! intecest rate of 3% compounded quarterly. How much money will ypu have in the account after 20 years?

HELLPPPPP!!!!! MEEEE PLEASEEEE

19. Which of the following sentences contains a helping verb? Amanda swims faster than Daniel. Our math teacher assigns lots of homework. I thought the

Solve for a. 21a + 17 + 15a = -48 A.) 65 B.) 65/36 C.) -65/36 D.) -65