4804378780 4804378780

18-02-2021
Biology

contestada

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Respuesta :

malakmohammed0101 malakmohammed0101

18-02-2021

CUGCUACAUCGUAGCUGGUAAC

Answer Link

Otras preguntas

Density measurements can be used to analyze mixtures. For example, the density of solid sand (without air spaces) is about 2.84 g/mL. The density of gold is 19.

did your stance change or evolve at all during your research? explain. 1.1.6 practice-argue your case

Using each of the five Key Vocabulary words, write a paragraph describing how adapting to the physical geography, developing new farming techniques, and produci

Are all civil right movement connected?

is shown below. Find the value of f(-4)

Gwen has loyalty card for a store that gives her a discount of 5% off the marked price of items. Office Chair $800, Acer Laptop $4580. (a) How much will she pay

Do Correctly Walking is not the most exciting form of exercise a person can take on for fitness. Yet it is low impact and requires no fancy equipment. That make

"Es (will) nie passieren." O wird O werden O wirst O werdet

2 1/2 = 1 2/3 divided by y; what does y equal

9. Tomato plants in a garden are not growing well. The gardener hypothesizes that the soil is too acidic. To test this hypothesis accurately, the gardener could