yema yema
  • 18-11-2016
  • Biology
contestada

Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT
TACGCGACGTGCACGTGCAA MRNA-----

Respuesta :

Tuniss
Tuniss Tuniss
  • 18-11-2016
I believe A translates to U, T transtates to A, G translates to C, and C traslates to G.

 ATGCGCTGCACGTGCACGTTTACGCGACGTGCACGTGCAA 

mRNA

UACGCGACGUGCACGUGCAAAUGCGCUGCACGUGCACGUU


Answer Link

Otras preguntas

If you have  24 25 26 And 28 what is the mean
5x+10=24-2x what is this called?
Lisa wants to cover the top of the lid in beads. She has enough beads to cover 42 square centimeters. Find the area of the lid. Can Lisa cover the top in beads?
Six friends share 5 small pizzas. Each friend first eats half of a pizza. How much more pizza does each friend need to eat to finish all the pizzas and share th
what were some of Mae jemison duties on board the shuttle endeavor? help please!!!
big dipper. how did this constellation get its name.
Which Idea was once accepted is now considered a scientifically inaccurate A.tge nucleus is the center of the atom b.an atom is solid material c.electrons have
What is the difference between movement and locomotion?
what is 12/21 reduced to
A(n)________is what your body does in reaction to a stimulus.