hdiaz931
hdiaz931 hdiaz931
  • 22-02-2017
  • Biology
contestada

Part 1: CCATAGCACGTTACAACGTGAAGGTAA
Convert it into RNA
List Amino Acids and do the same with
CCGTAGCATGTTACAACGCGAAGGCAC
thanks :3

Respuesta :

dana1321 dana1321
  • 23-02-2017
RNA--GGUAUCGUGCAAUGUUGCACUUCCAUU
Answer Link

Otras preguntas

What are the intercepts of the equation 7x-2y-14z=56
challenges faced by early settlers, such as food, shelter, transportation, illness, education, and community organization
(SC.8.P.9.3) Which of the following is an endothermic process? A. Condensation B. Freezing C. Solidification D. Evaporation
what is the completely factored form of 8x^2-50? A) 2(x+5)(x-5) B) 2(2x-5)(2x-5) C) 2(2x+5)(2x+5) D) 2(2x+5)(2x-5)
What is the tenth term of the geometric sequence that has a common ratio of and 36 as its fifth term?
How many moles of nitrogen monoxide will be generated when 0.83 moles of nitrogen dioxide gas reacts with water? 3NO2 + H2O 2HNO3 + NO0.277 moles0.415 moles0.
The text of Mozart’s Requiem is sung in:
what is a subcontractor that manufactures parts for other companies called?
The singing of an opera singer caused a drinking glass to shatter. Explain this using what you know about resonance.
Describe how Soviet nationalism grew under Stalin and the role it had in Soviet society.