hjelmert14 hjelmert14

19-06-2017
Mathematics

contestada

a road sign is in the shape of a regular pentagon. what is the measure of each angle on the sign

Respuesta :

musiclover10045 musiclover10045

19-06-2017

answer is 360/5= 72 degrees

Answer Link

Otras preguntas

the iroquios perform rituals to honor the twins in the world on turtles back illustrating the iroquoian belief that

if g^-1(x) is the inverse of g(x) which statements must be true

Define square root. Give an example.

According to the following reaction, how many moles of dichloromethane (CH2Cl2) will be formed upon the complete reaction of 0.766 moles methane (CH4) with exce

If x + 4 is one factor of x3 + 64, what is the other factor?

Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCC

The values in the following matrix are treatment means from a two-factor study. One of the means is missing. What value for the missing mean would result in no

Predict the reactivity of silicon in water relative to that of sodium, magnesium, and aluminium. Explain your answer. How does the reactivity of the halogens va

"During extended periods of high inflation, it can be expected that common stock price movements, as measured by the NYSE Composite Index, will show a:"

Which of the following is the solution to 4/5 = 20/(x-5)?