jahjr8995p165tv jahjr8995p165tv
  • 18-12-2017
  • Mathematics
contestada

How do you write 14 and 33 hundredths as a decimal

Respuesta :

Ravon326
Ravon326 Ravon326
  • 18-12-2017
convert 14/100 to a decimal.

Just divide 14/100 = 0.14



33/100 = 33 ÷ 100 = 0.33

Answer Link

Otras preguntas

Multiply the binomials below. Drag the answers below to their corresponding question. Using the box method. How do I use the box method?
Why wasn't Dahl's daughter, Olivia, vaccinated against the measles? O a Dahl was afraid of the consequences of vaccines. Оь Dahl believed the government could n
The USA PATRIOT Act spans multiple federal agencies, creating challenges for effective coordination. a) True b) False
Which of the following property types are covered by the Illinois Carbon Monoxide Alarm Detector Act?a. Commercial onlyb. Residential and commercialc. Residenti
The signing of a contract (or agreement) - which is in writing - turns that contact into an "executed" contract. A) True B) False
Discuss the pathophysiology of acute renal failure in rhabdomyolysis.
A strand of mRNA has the following sequence: CGCAUAUGCGUAUGCGUAAUAUAUGUUUUCCAAAAUAACAGCAGUAA
The nurse is reviewing information about percutaneous transluminal coronary angioplasty (PCTA) with the client. Which of the following should the nurse include
The most common minerals within Earth are ______. a. oxides b. hydroxides c. silicates d. carbonates.
A bond has 10 years to maturity and has a $60 coupon. Current bonds yield 4%. What is the current value of this bond if this is a semi-annual bond? a) $953 b) $