giannampalmer00 giannampalmer00

18-03-2020
Mathematics

contestada

4/(x+8) - 2/(x-8) = (4x)/(x^2-64)

what variable would make the denominator zero?

Respuesta :

mirkatanquero mirkatanquero

18-03-2020

Answer:

Answer:

x=−24

Step-by-step explanation:

the only variable is x and -24 is the value of this variable

Answer Link

Otras preguntas

(My Health teacher switched the 'True' and 'False' around to trick us! XD) Being overweight or obese increases the risk of health problems like diabetes and hig

What is 75/150 as a decimal

Locate and identify the -ing form. The children jumping rope are in first grade. verb phrase participle gerund

Jose gets up from his seat on the bus to move closer to the front. Just as he begins to walk forward, the bus stops at a light. What is the best explanation of

How does Callaghan use indirect characterization to create tension between the two characters

What is 195 squared to the nearest integer

Political alienation makes individuals more likely to get involved with the government and community. False True

Which of the following is a chemical change? a. mixing b. melting c. grinding d. tarnishing?

Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----

Which goal of monetary policy is missing from the list: economic growth, stable prices and _________? Question 9 options: A) balance of trade B) full employ