christopher5265 christopher5265

16-04-2020
Biology

contestada

Explain the relationship between these two chemical equations.

Explain the relationship between these two chemical equations class=

Respuesta :

emma23131 emma23131

16-04-2020

Answer:

The first equation is for the photosynthesis and the second equation is for the cellular respiration. so the output of the photosynthesis is the input for the cellular respiration and vice versa.

Explanation:

Answer Link

Otras preguntas

b is the midpoint of AC and D is the midpoint of CE solve for x given BD = 3x+4 and AE = 5x+19

Part 1: CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks :3

Could chromosomes 2 be homologous with chromosome 1?

As Rome expanded, the conquered territories sent payments that honored the acceptance of the new rulers. What were those payments called

A park ranger would like to clear more than 10 mi of trail. So far, he has cleared 2 mi. From now on, he can clear 3/4 mi of trail each hour. Question:What stat

I need to know the temperature changes

Tasha, Felicia, and Alex are cousins. Tasha is twice as old as Alex, and ELicia is two years older than Tasha. The sum of their ages is 37. Use the 5D Process t

I don't understand this . . .

Look at the following reaction. Select the option that best applies to the reaction. The number of atoms in the product is greater than the number of atoms in t

Select all that apply. Parts of the inner ear include _____. cochlea lateral canal auditory canal semicircular canals auricle