Shanaebrookins1
Shanaebrookins1 Shanaebrookins1
  • 19-11-2020
  • Mathematics
contestada

Given the diagram below, find the value of x and find m<2

Given the diagram below find the value of x and find mlt2 class=

Respuesta :

lucyanddede
lucyanddede lucyanddede
  • 19-11-2020

Answer:

x= 15, m<2= 50

Step-by-step explanation:

5x+55 and 2x+100 are equal

5x+55=2x+100

5x=2x+45

3x=45

x=15

Plug it into 5x+55

5(15)+55 = 130

^That angle and <2 are supplementary, so they need to= 180

130+ m= 180

m<2= 50

Answer Link

Otras preguntas

How did the case of Marbury vs. Madison help the judicial branch of government ?
Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----
What is the definition of contemporary health?
explain how both a biochemist and a food scientist may assist in making sure people consume a more nutritious diet
Which parts of this passage from Beowulf indicate that the poem is about war and glory? Lo! the Spear-Danes’ glory through splendid achievements The folk-kings’
The painter caught the ______ flush of youthful embarrassment.
Mesopotamia developed in what is now the southern part of what country?
Which of these are electromagnetic waves? A. light and radio waves B. sound waves C. ocean waves and earthquake vibrations
Find the value of x when 2(x - 3) + 1 = 3x + 4 A) -1 B) -1/5 C) -9/5 D) -9
if 2005 sales was 6,000,000 and 2001 sales was 2,000,000 what is the percent increase