9dvhj83r5n
9dvhj83r5n 9dvhj83r5n
  • 20-11-2020
  • Mathematics
contestada

I’m not sure how to do this, someone please help.

Im not sure how to do this someone please help class=

Respuesta :

cfox1259 cfox1259
  • 20-11-2020

Answer:

A

Step-by-step explanation:

Answer Link
s5284393
s5284393 s5284393
  • 20-11-2020

Answer: It is E (3, -7)

Answer Link

Otras preguntas

a hardware store had monthly sales of $69,600
The French clothing measurements are numbers in centimeters?
A kitchen floor has 15 1/2 tiles in an area of 2 4/5 square feet. How many tiles are in one square foot?
What does three feet on the floor mean?
Biomes are major groupings of plant and animal communities that are defined by _____.
Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----
The role of a watershed is to _____. A. purify water. B. act as a drainage area. C. collect fish from rivers and streams. D. protect wetland areas.
What is 450 g of flour a measure of? mass weight gravity inertia
A person watching televsion will have a blank heart rate
50 students in 4 buses