anthony7946 anthony7946
  • 20-11-2020
  • Mathematics
contestada

Determine the slope of the line in the graph

Determine the slope of the line in the graph class=

Respuesta :

jrmdkfjgvnigfkdjnvgd jrmdkfjgvnigfkdjnvgd
  • 20-11-2020

Answer:

4 and -2

Step-by-step explanation:

Answer Link
s1m1
s1m1 s1m1
  • 20-11-2020

Answer:

1/2

Step-by-step explanation:

the slope = rise /run

Look at the graph to find 2 points that are easy to read for example (0, -2) and (4, 0).

How did you got from (0, -2 ) to (4, 0) by rising 2 and run 4 so your slope is

m=2/4=1/2

Answer Link

Otras preguntas

Compute the amount of interest earned in the following simple interest problem. A deposit of $800 at 3.5% for 7 years = _____.
rewrite the equation 5x-2y-7
Order these in ascending order plz.. -5/7, -6/7,-.321,-.883,-4/7
A star with a spectral class of b2 and an absolute magnitude of 0, would be a _____________ star.
what does the first number mean of the pants size 32x32?
Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----
Using the model below what is the product of 4 x 492
Which best describes what a story's ending does? A. Shifts the focus of the story to a new topic B. Continues to build tension the story has created C.
What’s the body count for the film halloween??
Why did many Americans support the British IN World War 1.