ariu0rlydialabbyb
ariu0rlydialabbyb ariu0rlydialabbyb
  • 17-10-2016
  • History
contestada

What was the first car?

Respuesta :

CrunchyPanda
CrunchyPanda CrunchyPanda
  • 17-10-2016
Karl Benz from Germany made the first legit car in 1885/1886 named Benz Patent Motor Car. 
Answer Link

Otras preguntas

If the initial margin is $5,000, the maintenance margin is $3,500 and your balance is $4,000, how much must you deposit?
Find the balance in the account after the given period. $4000 principal earning 6% compounded annually, after 5 yr
11x-13y=89 -11x+13y=107 solve with elimination
Scores on an exam follow an approximately normal distribution with a mean of 76.4 and a standard deviation of 6.1 points. what is the minimum score you would ne
Identify the nations that belonged to the Central Powers and the Allied Powers. Germany RussiaItaly Austria-Hungary Ottoman Empire France Japan
Part 1: CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks :3
What is the solution to the inequality? 10x+18<−2 ​ x<2 ​ ​ x>−2 ​ x<−2 ​ x>2 ​
Describe the current atomic model.
What is the answer for this equation P=r+s-6
There are 36 carpenters in a crew. On a certain day, 29 were present. What percent showed up for work? (Round to nearest tenth)