galaxyvlogsxoxo galaxyvlogsxoxo
  • 21-04-2021
  • Physics
contestada

may anyone please help me with all of this side of the packet?:) ill give all my points for this :(

may anyone please help me with all of this side of the packet ill give all my points for this class=

Respuesta :

pf1234 pf1234
  • 21-04-2021

Answer: 4 is b 8 is c

Explanation:

Answer Link

Otras preguntas

An angle measures 28° more than the measure of its supplementary angle. What is the measure of each angle?
Transribe and translate the following dna strand GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT
Please help! Mildly confused on how to solve it
Which technique of satire does Swift use in paragraph 16?
An isosceles triangle has a base of 2x - 1, a leg of 3x - 18, and another leg of 21. Find the following: X = Length of the Base = Length of the other leg =
ST, a vertical pole 2 metres high, is situated at the corner of a rectangular garden, PQRS. RS is 8 metres long and QR is 12 metres long. Ł Q P M 12 m The pole
When free riding threatens to prevent a group from providing a public good, the group faces what is called a
What organelle contains genetic material?
gods zeus athena perseus
find the equation of tangent and normal to the surface z^2=4(1+x^2+y^2)at (2,2 ,6)