hanKfsca5b5itt hanKfsca5b5itt

17-12-2016
Mathematics

contestada

What is the answer to this equation 5m 6=46?

Respuesta :

Shyprincess123456 Shyprincess123456

17-12-2016

m =8
you solve for m , subtract 6 from both sides , then you will get 5m=40 , now you divided 5 from both sides to get m by it self ,so m will equal to 8 .

Answer Link

Otras preguntas

When carbon dioxide is formed, one carbon atom forms double covalent bonds with two oxygen atoms. Carbon dioxide is considered

what is the best tv show?

Scott is experiencing gallstones. The gallstones have caused cholecystitis (inflammation of his gallbladder). Scott’s condition affects which body system

The distance of planet Mercury from the Sun is approximately 5.8 ⋅ 10^7 kilometers, and the distance of planet Venus from the Sun is 1.1 ⋅ 10^8 kilometers. Abou

find the common denominator 5/10 and 2/5

2/v + 2 = 9 solve for v

Part 1: CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks :3

why can iron be used to get copper from copper sulfate solution

Which excerpt from Samuel Taylor Coleridge's "Kubla Khan" most clearly indicates that he has forgotten much of the dream he relates? "Could I revive within me/

The measure of an angle is 41°. What is the measure of its complement? 39° 49° 129° 139°