marciaalvesrodrigues marciaalvesrodrigues
  • 17-11-2021
  • Mathematics
contestada

X+3y=55 -x+2y=20
Me ajude por favor

Respuesta :

firered21
firered21 firered21
  • 17-11-2021

Answer:

x + 3y = 55

-x -x

3y = -x + 55

3 3

y = -1/3x + 55/3

-x + 2y = 20

+x +x

2y = x + 20

2 2

y = 1/2x + 10

Espero que esto ayude :)

Por cierto, no soy un hablante nativo de español.

Answer Link

Otras preguntas

Two countries produce copper and lead. Country A can produce a maximum of 300 tons of copper per day or 150 tons of lead. Country B can produce a maximum of 400
20 POINTS AND BRAINLIEST HURRY HELP Rectangle ABCD is in the coordinate plane. Which of the following is a valid definition of a reflection of rectangle ABCD? A
(Brainliest) Where was the Confederates’ last stand just before they surrendered? Appomattox, Virginia Port Hudson, Louisiana Gettysburg, Pennsylvania Vicksburg
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
Pls help me with this question.
How dose the brain processes information from stimuli? write 5 to 7
How does Fredrick Douglass define life
what is the type of trial system that we have here in the United States
BRAINLIEST AND 50 POINTS FOR THE FIRST CORRECT ANSWER Read the excerpt from White Fang. The man who had spoken came over to her. He put his hand upon her head,
the distance between two cities on a map is 13cm.What is the actual distance between the cities if the map is drawn at a scale of 1:50,000?